Suggested problems

How To Fix Water Damaged Lenovo Phone?

Nov. 21, 2020, 12:18 p.m. by AngelaAngie

Biological Motivation

So, have you dropped your phone into your sink, toilet, or pool? If yes, then don’t panic at all. All you need to do is to Fix Water Damaged Lenovo Phone as soon as possible. All you need to do is to read this information until the end. This will aid you in guiding to fix the issues with the help of the support system. whenever if you need quickest way to crack such a situation is to get on your cell phone to dial the [Lenovo Telefoonnummer][1].

[1]: https://klantenservicenummernl.mystrikingly.com/blog/hoe-een-door-water-beschadigde-lenovo-telefoon-te-repareren

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21