Suggested problems

mcafee.com/activate

Nov. 21, 2020, 9:21 a.m. by rolfkimma

Biological Motivation

[mcafee.com/activate][1] [mcafee.com/activate][2] [mcafee.com/activate][3] McAfee is one of the best security tools for any of your devices. This is not just a regular tool that removes small viruses and reports bugs. But this is one whole full security provision for your Device.McAfee Antivirus lists the IP addresses connected with the threat, which allows tech-savvy users to avoid websites connected to those addresses.

[1]: http://mcafeecomact.com/ [2]: http://mcafeecom.site/ [3]: http://mcafee-home.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21