Suggested problems

Independent Escorts In Goa

Nov. 20, 2020, 5:56 a.m. by Soniya Thakur

Biological Motivation

...Fantasy Goa Escorts Girl Soniya looking for your time in which she can make you pleasure with her service in hotel room. If you're ready for that just call on our registered number for more exciting more fun.Visit:- http://www.soniyathakur.com/

[Independent Escorts In Goa][1] [Escorts In Goa][2] [Goa Escorts Service][3] [Goa Independent Escorts][4]

[1]: http://www.soniyathakur.com/ [2]: http://www.soniyathakur.com/ [3]: http://www.soniyathakur.com/ [4]: http://www.soniyathakur.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21