Suggested problems

SAYEED'S INSTITUTE OF PROFESSIONAL STUDIES (SIPS)

Nov. 18, 2020, 3:50 p.m. by sipslucknow1234

Biological Motivation

SIPS is a team of who have vast and rich experience in the field of higher education and had serviced in various reputed universities of India. SIPS is a respected name in the field of education and admission consulting services. SIPS established by the Sayeed’s educational and social foundation, is a non profit making entity supported and financed by Sayeed’s educational and social foundation U.P.

[https://sipslucknow.in/][1]

[1]: https://sipslucknow.in/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21