Suggested problems

Buy Gmail Accounts

Nov. 18, 2020, 1:14 p.m. by pvagmail

Biological Motivation

Gmail is a paid and free online service that is provided by Google, producing users with space of message storage and all systems charge a supplementary storage fee. Yahoo Mail has a search capability the Hotmail service provided by Microsoft does not. [Buy Gmail accounts][1] which are the best for individual and business with all the features like storage.The company's platform can scan messages from users to assess advertisement matches and insert relevant advertisements in email messages from time to time. Some have raised concerns about issues of privacy and the ads. So, avail the featureof our Gmail accounts with full privacy and security guarantees.

[1]: https://pvagmail.com/google/buy-gmail-accounts/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21