Suggested problems

Testbanksonline

Nov. 17, 2020, 6:43 a.m. by robinsmithsters

Biological Motivation

If you are looking for test banks online, the best place for Testbank Downloads would be TestBanksOnline. Do not wait to buy https://testbanksonline.com/tbsm/solution-manual-for-practice-of-physics-chapters-1-34-global-edition-1st-edition/">Solution Manual For Practice Of Physics Chapters 1 34 Global Edition 1st Edition online anymore. Get Test Banks Download and improve your grades. TestBanksOnline is the best website to Buy Test Banks Online. Great study materials like https://testbanksonline.com/tbsm/solution-manual-for-operations-management-processes-and-supply-chains-international-edition-11th-edition/">Solution Manual For Operations Management Processes And Supply Chains International Edition 11th Edition are available with instant download and best discounts. Search 4000+ test banks and solution manuals online.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21