Suggested problems

UGC NET Complete Syllabus & Exam Pattern 2020

Nov. 12, 2020, 7:08 a.m. by Anuj Jindal

Biological Motivation

UGC NET Exam 2020 Expected Cutoff Marks: Check NTA UGC NET 2020 Expected Cut-Off & Minimum Qualifying Marks both subject-wise and category-wise (Gen/EWS/OBC/SC/ST).

UGC NET Exam 2020 Expected Cutoff Marks: NTA is conducting the UGC NET June 2020 Exam till 13th November 2020. Candidates who are appearing for the UGC NET 2020 Exam and will be appearing for this exam in the future must check the expected cut-off marks & minimum qualifying marks required to get shortlisted for ‘Assistant Professor” & Junior Research Fellowship (JRF) under different categories like General, EWS, OBC, SC &ST. So based on the difficulty level of the Paper 1 and 2, we have guestimated the Cut-Off Marks of NTA UGC NET 2020 Exam.

[UGC NET Previous Year Question Paper][1]

[1]: https://www.anujjindal.in/ugc-net-jrf-previous-year-papers-cut-off-and-preparation/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21