Suggested problems

How To Use Arlo App For PC?

Nov. 10, 2020, 6:27 a.m. by Arloappforpc

Biological Motivation

If you are a novice user and don’t know [How To use Arlo App For PC][1]? Don’t worry we will help in each and every problem regarding the Arlo. You can use the Arlo app for many uses like if you want a live view then you can directly connect to your camera by the Arlo app. You can check moisture and motion with the help of the app. If you are not satisfied with the above information and want to know more about the Arlo app then you can contact our representatives anytime at + 1 844 641 1174 We are working 24/7 hours.

[1]: https://247camerahelp.com/arlo-app-for-pc/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21