Suggested problems

Security problems

Nov. 9, 2020, 6:20 a.m. by jacktenben

A Rapid Introduction to Molecular Biology

Be Safe

[mcafee activate][1] || [mcafee.com/activate][2] || [norton.com/setup][3] || [norton setup][4] || [office.com/setup][5] || [hp printer in error state][6]

Secure with antivirus

[www.mcafee.com/activate][7] || [www.norton.com/setup][8] || [www.office.com/setup][9] || [office setup][10] || [hp wireless printer setup][11] || [hp printer help][12]

Let's download

[mcafee download][13] || [norton download][14] || [microsoft office download][15] || [office download][16] || [hp printer troubleshooting][17]

[1]: https://mcafeeactivatenow.com/ [2]: https://mcafeeactivatenow.com/ [3]: https://www.norton-set-up.com/ [4]: https://www.norton-set-up.com/ [5]: https://setupofficecomsetup.com/ [6]: https://product-hotline.com/hp-printer-support/ [7]: https://mcafeeactivatenow.com/ [8]: https://www.norton-set-up.com/ [9]: https://setupofficecomsetup.com/ [10]: https://setupofficecomsetup.com/ [11]: https://product-hotline.com/hp-printer-support/ [12]: https://product-hotline.com/hp-printer-support/ [13]: https://mcafeeactivatenow.com/ [14]: https://www.norton-set-up.com/ [15]: https://setupofficecomsetup.com/ [16]: https://setupofficecomsetup.com/ [17]: https://product-hotline.com/hp-printer-support/ ...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21