Suggested problems

PassUp-Letgo Clone

Nov. 6, 2020, 6:48 a.m. by Jenson

Biological Motivation

...PassUp - Letgo Clone is the Script that is designed with comparable highlights and functionalities from the conceptualization of the Letgo Clone and it is focused to improve the online classified business.Our quality driven content can possibly adjust for the assorted business to yield better outcomes and it keep up and classify.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21