Suggested problems

How to Fix QuickBooks Web Connector Error QBWC1085?

Nov. 2, 2020, 12:09 p.m. by Adelina Martin

Biological Motivation

QuickBooks web connector is an application that enables qbXML and qbposXML to pass between a web-based application and QuickBooks point of sale. The user might face some issues while using the application and [QuickBooks web connector error QBWC1085][1] is one of them. This error is related to the log file of QuickBooks. This error is usually seen when the user tries to open the company file and restricts the user to write the log files. You may see the following error message on your desktop screen:

![https://qbsenterprisesupport.com/wp-content/uploads/2020/01/QBWC-Error-1085-screenshot-3.png][2]

QBWC1085: QuickBooks was unable to write to the log file. QuickBooks will open without writing to log file. QBWC1085: There was a problem with the log file. QuickBooks Web connector will continue without the log file. Exception TypeError: Unknown name.

In today’s post, we will be talking about the process to fix this QuickBooks Web Connector Error QBWC1085, along with the causes. Thus, scroll through the post or you can also contact our [QuickBooks error support][3] team via our toll-free number. Our experts will help you in fixing the error with much ease.

Causes of QBWC1085 error in QuickBooks Web connector The user might face this error due to the below mentioned factors: • QB web connector failed to write the log file • Or the QuickBooks software will open without writing the log file • Another cause can be if there is an issue with the log file • Or the QuickBooks connector proceed without log file

Steps to Rectify QuickBooks Web Connector Error QBWC1085 There can be a couple of steps that the user can follow in order to fix the error QBWC1085: • The very first step is to press Windows + R keys • And then open the Run window • Also, the user will have to type MSConfig and click on OK button • Now, click on the startup tab • Followed by searching and marking the checkbox for QuickBooks web connector • After that the user needs to click on Apply and OK button • The last step is to reboot the system and see if QuickBooks web connector error is resolved

With this, we come to the end of this post, where we expect that the QuickBooks Web Connector Error QBWC1085 would be resolved after carrying out the steps above.

However, if the error persists, then feel free to call us at 1-800-761-1787, and our [24/7 QuickBooks enterprise support][4] professionals will resolve the error for you.

[1]: https://qbsenterprisesupport.com/quickbooks-web-connector-error-qbwc1085/ [2]: https://qbsenterprisesupport.com/wp-content/uploads/2020/01/QBWC-Error-1085-screenshot-3.png [3]: https://qbsenterprisesupport.com/quickbooks-error-support/ [4]: https://qbsenterprisesupport.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21