Suggested problems

Gst Registration in Jaipur Rajasthan

Oct. 27, 2020, 5:48 p.m. by SAJID112233

Biological Motivation

GST Registration in Jaipur Rajasthan[GST Registration][1] India in Rs 999/- Only. GST Return Filing in Rs 499. Avoid Late Panelty, File ITR on Time. New GST Registration Online

[1]: https://www.e-startuprajasthan.com/gst-registration

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21