Suggested problems

We have derived a DraftKings clone app to help you enter the field of fantasy sports app

Oct. 22, 2020, 10:35 a.m. by Marcus2804

Biological Motivation

Silver bullets of DraftKings Clone App: The fantasy sports app is pulling our attention in recent times. DraftKings clone app is curated keeping the latest trends in the virtual gaming platform.

Like any other fantasy sports app, the DraftKings clone has all the key features. In addition to that, the DraftKings clone app has premium features that make the app outward from its competitors. Here are the features:

Real-time score panel- The DraftKings clone app has a real-time score panel that makes the players enthusiastic about the scores.

On-time message alerts- Users will get notified about the match timings, upcoming matches via push notifications.

Integrated CRM- The app has an integrated CRM that treasures the customer queries, and the admin will resolve them.

Ductile payment options- Since the users have to make an entry fee to avail of services, the app has varied payment options like debit/credit card and net banking facilities.

Player stats- With an app like DraftKings, users can view the player stats, which has the player records like player score, winning rate, and performance in every match.

Why should you opt for the DraftKings clone app from us?

In addition to the above standard features, we also provide live chat options that allow users to chat with other users. We provide a Leaderboard panel that updates the user, and their teams based on the winning rate. Of all, we provide running commentary to cheer the players.

Conclusion: With any further drag, you can book a demo with us to specify your requirements and we are here to help you. Solutions we provide are 100% white-labeled and are highly customizable.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21