Suggested problems

Remitano Clone Script

Oct. 20, 2020, 5:51 a.m. by Maticz

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

Remitano clone script is the peer to peer crypto exchange Solution to start your own crypto exchange platform like Remitano. It provides Crypto exchange and trading services in multiple countries. Remitano Clone script has a well-designed interface and it offers a great trading experience for its users. The business-ready white-label Remitano Clone Script has all the necessary features essential that are key to running the exchange platform successfully.

The Remitano Clone platform has a powerful dispute management system that allows the website admin to moderate, intervene and resolve controversy between the parties involved in a decent manner.

The Remitano Clone Script and Clone app makes easier for users to trade whenever and wherever as it is available on the Web, mobile apps for android and iOS devices.

[See our Demo Version][1]

  [1]: https://maticz.com/remitano-clone-script