Suggested problems

What is wazirx clone script ?

Oct. 20, 2020, 5:49 a.m. by Maticz

Biological Motivation

WazirX Clone script is premier P2P cryptocurrency exchange platform software that developed on the lines of the top crypto exchange player WazirX. It supports a range of popular cryptocurrencies like Bitcoin, Litecoin, Ethereum, etc., and facilitates buying and selling of them among users.

Intensified with critical security levels, the WazirX Clone is a metaphor of first-rate features and delightful crypto exchange experience. Its intrinsic high scalability mentions its ability to handle millions of transactions and concurrent users seamlessly.

[Try our WazirX Clone Script Demo!][1]

[1]: https://maticz.com/wazirx-clone-script

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21