Suggested problems

Maintained Her Fitness In A Beautiful Way By Our Bandra Escort Ritu Sharma Call Me 9004009481

Oct. 16, 2020, 11:33 a.m. by Ritu Sharma

Biological Motivation

Escort services are no longer available only to the rich. Hi I am Ritu Sharma. I am a popular escort girl in Mumbai. Even more, I have my own group of special [Mumbai Escorts][1]. My services are cheap but my girls are top grade. Variety is the spice of life. So, ditch your partner at home. Make an excuse and come spend a night with one of my sexy call girls. Spending a magical night with a Girl Escort is every man’s dream.!

[enter image description here][2]

There is now a very easy way to get [Mumbai Escort Service][3]. Can sex life be better than getting a particular vagina? If evidence is found that all Mumbai Escorts can increase your libido, masculine power or Sexual Pleasure, then perhaps this will be done hands on. A hot sexy Escort Call Girls, active lifestyle and good sexual health and fun can increase your sex life. But are there any special Escort Call Girls that can actually enhance the natural sex life? Let's look at the history behind this Star Hotel and the Hotel Room whether a Genuine Escort Service can really improve your sex life.

You don’t need to burn your pocket for coming to us. We do care for you. So that, we make our rates your pocket friendly. If you are our regular guy, then you are our favorite. We are very friendly in all ways. We always have a special discount for you. You can choose hour basis or night basis. Come over for the night. We are for you anytime. We also have offer for our new customers. This is called as an introductory offer Mumbai escort service.

Call Me 9004009481 Visit My Website https://www.escortservicemumbai.net/

...

[1]: https://www.escortservicemumbai.net/ [2]: https://storage.ning.com/topology/rest/1.0/file/get/7968685062?profile=original [3]: https://www.escortservicemumbai.net/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21