Oct. 6, 2020, 7:13 a.m. by mia james
Biological Motivation
[norton.com/setup][1] [norton setup][2] [www.norton.com/setup][3] If you are using the internet or not on your device there always will be a need for strong antivirus to be installed to protect it against mischievous youths looking for a thrill or a hardened cyber-criminal wanting to take advantage of billion-dollar firms, can stop wanting to search out ways in which to commit fraud, cause widespread harm, or simply leak or use your personal data.
[1]: https://nortonsetup-nortoncom.com [2]: https://nortonsetup-nortoncom.com [3]: https://nortonsetup-nortoncom.com
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21