Oct. 6, 2020, 7:13 a.m. by mia james
Biological Motivation
[norton.com/setup][1] [www.norton.com/setup][2]
[1]: https://n-norton-norton.com On the off chance that you are utilizing the web or not on your gadget there consistently will be a requirement for solid antivirus to be introduced to secure it against devilish young people searching for a rush or a solidified digital criminal needing to exploit billion-dollar firms, can quit needing to look out manners by which to carry out extortion, cause far reaching hurt, or essentially break or utilize your own information. [2]: https://n-norton-norton.com
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21