Oct. 6, 2020, 7:12 a.m. by mia james
Biological Motivation
[office.com/setup][1] [www.office.com/setup][2] [Office setup][3] Office 365 can be more useful than just an email application if you pick the right participation plan. For business, improving benefit and joint exertion in the affiliation has gotten imperative to make it straightforward and progressively able for the delegates to work.But, amounts of associations are so far utilizing the major plans of Office 365, which limit them from utilizing the invigorated features. Thusly, to promise you get every component and use your Office 365 enrollment to the most. Buy your Office from Official www.office.com/setup
[1]: https://officesetup-officecomsetup.com/ [2]: https://officesetup-officecomsetup.com [3]: https://officesetup-officecomsetup.com
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21