Suggested problems

how to download ms office on any device.

Oct. 6, 2020, 7:10 a.m. by mia james

Biological Motivation

[office.com/setup][1] [www.office.com/setup][2]

[1]: https://get-officecom.com Office 365 can be more useful than just an email application if you pick the right subscription plan. For business, enhancing productivity and collaboration in the organization has become necessary to make it easy and more proficient for the employees to work.But, numbers of businesses are still utilizing the basic plans of Office 365, which limit them from utilizing the updated features. So, to ensure you get every feature and use your Office 365 subscription to the most. [2]: https://get-officecom.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21