Oct. 5, 2020, 11:24 a.m. by lakeviewblinds
Biological Motivation
Get stylish and modern [awnings][1] to cover up your window. Lakeview Blinds is the prominent and foremost name to fulfill your home decoration needs. We have been working for the last 25 years in this field. You can find modern and affordable awnings, shutters for your home. Visit the store to see what amazing deal we have to you. Visit our website for more info.
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21