Suggested problems

Data Science course in Bangalore

Sept. 26, 2020, 5:30 a.m. by vikrantrana

Biological Motivation

Data Science is one of the top trending technology of the era and data science has stretched its roots deep down in the corporate industry. Due to this vast inference, new age learners and working professionals are keen to learn this technology. To curb this, various online [data science course in Bangalore][1] are available through which one can master data science and begin career as a data scientist. Data science is a broad career path and is undergoing developments and thus promises abundant opportunities in the future. Data Science job roles are likely to get more specific, which will lead to specializations in the field. People inclined towards this stream can exploit their opportunities and pursue what suits them best through there specializations and specifications.

[1]: https://intellipaat.com/data-scientist-course-training-bangalore/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21