Suggested problems

kk

Sept. 25, 2020, 10:49 a.m. by selvakumarsingai

Biological Motivation

The d-neighborhood of the k-mer Pattern is the collection of all k-mers that are at most Hamming distance d from Pattern.

How many 5-mers are in the 2-neighborhood of Pattern = TGCAT?

Note that the d-neighborhood of Pattern includes Pattern.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21