Suggested problems


Sept. 22, 2020, 11:54 a.m. by selvakumarsingai

Biological Motivation

Identify the value of i for which Skewi (GCATACACTTCCCAGTAGGTACTG) attains a maximum value


A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset


Sample Output

20 12 17 21