Suggested problems

Headphone peredam bising nirkabel WH-1000XM3 generasi terakhir dari Sony dengan diskon $ 95

Sept. 18, 2020, 2:36 p.m. by Gesper666

Biological Motivation

Jika Anda mencari rangkaian headphone nirkabel dan over-ear hebat yang memiliki peredam bising dan kualitas suara yang bagus, WH-1000XM3 Sony adalah diskon $ 95 di Woot, turun menjadi $ 255. Woot menjual model hitam dengan detail perunggu di beberapa tempat. Itu baru dan memiliki garansi satu tahun. Ini bukan harga terendah yang kami lihat untuk model ini; harganya turun menjadi $ 200 setelah penggantinya, WH-1000X4, dirilis awal tahun ini. Dan dengan Prime Day 2020 dan Black Friday yang semakin dekat, kemungkinan kita akan melihat mereka pergi bahkan lebih sedikit. Meski begitu, model ini sangat bagus sehingga kami akan memberi tahu Anda kapan pun harganya lebih murah dari biasanya.

[code termux hack akun ff][1]

Tablet Samsung Galaxy Tab S7 dan S7 Plus tersedia mulai hari ini. Rekan saya Dan Seifert mengulas keduanya, memuji perangkat keras mereka yang luar biasa yang, sayangnya, terseret oleh aplikasi tablet Android yang buruk. Namun jika Anda berkomitmen untuk mendapatkannya, Anda bisa mendapatkan aksesori keyboard dengan potongan harga setengah dari biasanya jika Anda membelinya dengan tablet. Best Buy menghormati kesepakatan ini, dan situsnya memudahkan untuk menarik dan melepas aksesori tablet dan keyboard yang Anda inginkan ke dalam keranjang.

[hack akun ff dengan termux][2]

[script termux hack fb setan][3]

[script hack cctv][4]

[script termux terbaru][5]

[script hack fb][6]

[1]: https://www.gesper666.com/2020/08/script-termux-hack-akun-ff.html [2]: https://www.gesper666.com/2020/08/script-termux-hack-akun-ff.html [3]: https://www.gesper666.com/2020/08/script-termux-terbaru-2020.html [4]: https://www.gesper666.com/2020/08/script-termux-hack-cctv.html [5]: https://www.gesper666.com/2020/08/script-termux-hack-pulsa.html [6]: https://www.gesper666.com/2020/08/script-hack-fb-termux-osif.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21