Suggested problems

Steel Bite Pro Review

Sept. 10, 2020, 4:34 a.m. by jacobdavid

Biological Motivation

This dental hygiene supplement contains active and natural ingredients that help users maintain their dental health with ease. It is one of the most popular natural supplements in the oral health market right now. One of the reasons for this is the unbeatable price at which it is offered. [Steel Bite Pro review][1]. According to the [Steel Bite Pro review][2], Steel Bite Pro is herbal and contains many healthy vitamins and minerals that effectively improve and maintain the cleanliness of the mouth and teeth. The natural ingredients in dietary supplements are extracted from plants and subjected to laboratory testing to ensure their effectiveness and quality before being bottled together. The preparation does not contain additives or toxins, which makes it completely safe and free from harmful side effects.

[1]: https://www.phdsc.org/steel-bite-pro-review [2]: https://www.phdsc.org/steel-bite-pro-review

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21