Sept. 4, 2020, 9:21 a.m. by jack parker
Biological Motivation
We help you to stay at the top of the class with assignment help. The reason we have been the go to place for psychology writing service is our pool of finest assignment writing experts from Australia for all academic assignments. Our assignment helper have great writing skills and run a comprehensive assignment check to provide you with a custom online assignment. Our assignment writers are best academic experts.
https://www.gotoassignmenthelp.com/
...
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21