Suggested problems

App Development Company Toronto

Sept. 3, 2020, 5:35 a.m. by Julia Johnson

Biological Motivation

iQlance is the custom [App Development Company Toronto][1], which is churning out cost-effective solution for both small and large enterprise. The company also has the team of advertising space and offers innovative ad solution that includes networking and ad optimization.

Having years of experience in the IT industry, the company provides client’s centric approach and precise solution that helps the client’s business to reach new heights. Web development services include Asp.Net development, Angular development, Drupal development, Magneto development, Node.js development, UI/UX design and development and much more.

[1]: https://www.iqlance.com/toronto-mobile-app-development/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21