Sept. 3, 2020, 5:35 a.m. by Julia Johnson
Biological Motivation
iQlance is the custom [App Development Company Toronto][1], which is churning out cost-effective solution for both small and large enterprise. The company also has the team of advertising space and offers innovative ad solution that includes networking and ad optimization.
Having years of experience in the IT industry, the company provides client’s centric approach and precise solution that helps the client’s business to reach new heights. Web development services include Asp.Net development, Angular development, Drupal development, Magneto development, Node.js development, UI/UX design and development and much more.
[1]: https://www.iqlance.com/toronto-mobile-app-development/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
