Suggested problems

How to win the HGTV Dream Home

Aug. 27, 2020, 10:54 a.m. by sweepstakesoffers

Biological Motivation

Everyone wants to win the HGTV Dream Home Sweepstakes. It’s one of the most popular sweepstakes on the internet. The first thing you have to do is make sure you get your entry in every day. DO NOT SKIP A DAY! You can enter from your phone, tablet, computer.. go to the library and enter if you must. Skipping a day gives you one less entry.

![enter image description here][1]

The HGTV Dream Home Sweepstakes provides you with an extra daily entry. This is How to win the HGTV dream home! Make sure you use it! This will provide you with two entries per day. Think about it like you are getting two free lottery tickets every day. You don’t want to miss out on free lotto tickets do you?

You can enter the [HGTV Dream Home][2]

[1]: http://file:///C:/Users/DELL/Downloads/HOW-TO-WIN-THE-HGTV-DREAM-HOME.jpg [2]: https://www.sweepstakesoffers.com/hgtv-giveaway/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21