Suggested problems

norton.com/setup

Aug. 22, 2020, 9:52 a.m. by carloandy

Biological Motivation

Norton Security Standard can protect only one system. Norton Security Deluxe can be used for up to 5 systems, and Norton Security Premium can protect up to 10 systems. To know more about them and their comparison you can visit the official site of Norton. [https://nortonn-norton.com][1]

[1]: https://nortonn-norton.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21