Aug. 18, 2020, 11:51 a.m. by iirrhinstitute
Biological Motivation
IIRRH Institute is a pioneer in women's health care education and is committed to providing the best possible training experience. Members of our [Reproductive Medicine Fellowship][1] specialists are known for performing complex diagnostic and therapeutic procedures. The team consists of experienced gynecologists and embryologists.
For more info log on to: **[www.iirrh.org][2]**
[1]: https://www.iirrh.org/fellowship-rguhs.php [2]: https://www.iirrh.org
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21