Suggested problems

You will get instant solution of your Mcafee Antivirus Issues

Aug. 18, 2020, 8:19 a.m. by mcafeepro12

Biological Motivation

We are working as public beneficiaries as we share analyzed and evaluated solutions with people who are looking for a good solution on [McAfee login][1]. If you are also looking for such assistance. You can either go to our website or contact us via call.

[1]: https://mcafeepro.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21