Suggested problems

How To Make Money Online

July 28, 2020, 7:26 a.m. by Salih Agenter

Biological Motivation

Agenter is the best place for anyone who wants to earn more money online. Here you can make money in the form of commission by working for the business offers or referring them to the right individuals. You can also help others to make money online by referring to the leads.

To know more about [how to make money][1]

[1]: http://%20https://www.agenter.com/how-to-earn

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21