Suggested problems

video production company

July 27, 2020, 8:57 a.m. by vht now

Biological Motivation

Video Production Companies in Bangalore: VHTnow is a corporate video production Company create visual masterpieces. Our services also include ad film makers and ad film production houses in bangalore.

Contact: [video production company][1]

[1]: https://www.vhtnow.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21