Suggested problems

How to get the free vbucks currency online for your game.

July 25, 2020, 11:01 a.m. by joe786

Biological Motivation

Access our [V Buck Generator][1] to fill up your Fortnite gaming account with tons of free Vbucks at ease. We welcome you to the new world of Fortnite, where you must stay unique to save the entire world from crisis and cope up with your co-players or friends. All you need to have is [V Bucks][2] in your gaming account to purchase every other stuff the game offers in the first place. Remember the epic characters that you were dreaming to build and make it a part of your team, now is the time to make it for real. Prove yourself as the real boss and become an ultimate killing machine within the gameplay as well.

[1]: https://free-vbucks.org/ [2]: https://vbucksfree.app/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21