Suggested problems

bioinfo

July 19, 2020, 4:31 a.m. by gulfammushtaq007

Biological Motivation

chars = "ACGT"

def neighbors(pattern, d): assert(d <= len(pattern))

if d == 0:
    return [pattern]

r2 = neighbors(pattern[1:], d-1)
r = [c + r3 for r3 in r2 for c in chars if c != pattern[0]]

if (d < len(pattern)):
    r2 = neighbors(pattern[1:], d)
    r += [pattern[0] + r3 for r3 in r2]

return r

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21