Suggested problems

How to get reliable AT&T tech support quickly

July 18, 2020, 7:34 a.m. by patricktron

Biological Motivation

How to get reliable AT&T tech support quickly

AT&T is the telecommunications giant of the country. It is an integral part of the lives of millions of Americans through wired and wireless telephony. Consumers have a high regard for the company and its services.

Are you experiencing some minor technical issues with AT&T service these days? Is your mobile losing signals suddenly? Do you need support for the device you are using? Just dial 1-877-916-7666, our popular and trusted [url=https://www.assistanceforall.com/services/email-support/att-email-support/]AT&T tech support centre[/url], to get a quick and authentic resolution.

This is a toll free [url=https://www.assistanceforall.com/services/email-support/att-email-support/]AT&T help line[/url] that remains open at all times on all 7 days of the week.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21