Suggested problems

How to contact with QuickBooks Support Service

July 17, 2020, 7:46 p.m. by Anika401

Biological Motivation

[QuickBooks Support Phone Number][1] will help you to solve the issues, when a bug or an error might exhibit on the software desktop to make it unresponsive or not capable of functioning at all. Our experts will find in the main QuickBooks file and installation by assessing and rectifying those issues.

...

[1]: https://www.pentoday.com/solution/quickbooks-support-phone-number/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21