Suggested problems

App Development Canada

July 17, 2020, 5:31 a.m. by Julia Johnson

Biological Motivation

iQlance is a name you can rely on when you are looking for the best mobile app development company that can develop a customized mobile app as per your business requirements. We have an agile mobile app development process that works well in accordance with your requirements. Our top Toronto app developers will understand your business first and come up with a plan accordingly. Services: We offer a wide range of comprehensive mobile app development services such as Android, iOS, Swift app development, IBEACON app development, hybrid app development, XAMARIN app development or cross-platform app development.

Do you want to get a competitive edge over your rivals by introducing a mobile app for your business? Get one developed by best app developers in Toronto.

[https://www.iqlance.com/toronto-mobile-app-development/][1]

[1]: https://www.iqlance.com/toronto-mobile-app-development/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21