Suggested problems

Where to get best Digital Marketing Company?

July 13, 2020, 4:15 a.m. by Lina Carter

Biological Motivation

[NA Digital Solutions][1] provides SEO services with the help of which you will be able to gain higher ranking in SERP. They will help you in both On-Page and Off- Page SEO and optimize your website so that Google can rank it higher.

NA Digital Solutions will help you in doing SEO by location, technology, industry and other factors. So, they will help you in gaining organic reach worldwide. They will audit your website and consult you how to optimize your website.

[1]: https://www.nadigitalsolutions.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21