Suggested problems

Situs Gesper666 Itu Apa?

June 30, 2020, 4 a.m. by Gesper666

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

Gesper66 atau gesper666.com adalah sebuah blog/media digital yang mencakup berbagai informasi seputar bisnis, game, sejarah, cryptocurrency, teknologi dll.

Di jaman maju ini khususnya di dunia digital sangat penting sekali bagi kita yang besinambung dengan dunia digital harus sigap dan akurat untuk mendapatkan informasi agar kita bisa mengetahui informasi-informasi terbaru tentang dunia digital.

Di Gesper666 bisa menjawab kebutuhan kamu semua tentunya yang ingin mendapatkan informasi tentang banyak hal yang kalian belum ketahui.

Tentang Gesper666

Gesper666 didirikan tahun 2019, gesper666.com adalah blog/media digital yang mencakup beberapa kategori informasi seputar dunia digital.

Gesper666 di miliki oleh seorang anak muda dari jawa timur (jember) yang bernama Azzar. Dia mendirikan Gesper666 dari tahun 2019.

Itulah situs Gesper666 atau gesper666.com yang bisa kamu kunjungi untuk melihat informasi tentang seputar informasi dunia digital. Semoga artikel ini bisa bermanfaat dan jangan lupa untuk share artikel ini agar semakin banyak orang orang yang mengetahui dan membaca karena dengan membaca kita jadi tahu.

https://www.gesper666.com

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21