Suggested problems

روضة الرياض للخدمات المنزلية

June 26, 2020, 4:50 p.m. by medoo

Biological Motivation

[روضة الرياض][1]

[شركة تنظيف بالرياض][2]

[شركة تنظيف بالباحة][3] [شركة عزل اسطح بالباحة][4]

[1]: https://rawdat-alriyad.com/ [2]: https://alqudsclean.com/ [3]: https://rawdat-alriyad.com/%D8%B4%D8%B1%D9%83%D8%A9-%D8%AA%D9%86%D8%B8%D9%8A%D9%81-%D8%A8%D8%A7%D9%84%D8%A8%D8%A7%D8%AD%D8%A9/ [4]: https://rawdat-alriyad.com/%D8%B4%D8%B1%D9%83%D8%A9-%D8%B9%D8%B2%D9%84-%D8%A7%D8%B3%D8%B7%D8%AD-%D8%A8%D8%A7%D9%84%D8%A8%D8%A7%D8%AD%D8%A9/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21