Suggested problems

App Development Canada

June 24, 2020, 7:17 a.m. by Julia Johnson

Biological Motivation

I’m KrunalVyas, IT consultant at iQlance Solutions Pvt. Ltd, is one of the leading Website and [Mobile Apps Development Company][1] Based in Toronto & Australia, I have helped more than 200+ clients to bring idea in to reality. I have attended many tech conferences as a company representative and frequently blogs about the search engine updates, technology roll-outs, sales & marketing tactics, etc. for more details visit our website : [https://www.iqlance.com/][2] and Email us on : info@iqlance.com

[1]: https://www.iqlance.com/mobile-app-development/ [2]: https://www.iqlance.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21