Suggested problems

Where to learn golf in Canada?

June 20, 2020, 3:07 a.m. by Lina Carter

Biological Motivation

Are you a Golf lover? Want to become a pro player of Golf? Then here is the answer.

Oakville is the world’s best place in golf instruction and golf club fitting. So, if you want to learn golf in Oakville or a nearby location then you must go to Mandeo Singh Pathania. A professional golf instructor who gives private and semi private golf lessons.

[Mandeo Singh Pathania][1] - Best Golf Teacher

Mandeo is a [professional golf instructor][2] who has won many world class tournaments. He turned pro in 2005 and earned “Rookie of the year” award. He has trained with world’s number one players Bob Toski and Jim McLean. And now he gives golf lessons at the academy of ClubLink at Glen Abbey Golf club in Oakville and Rattlessnake Point golf club in Milton.

He has very good experience as a Golf instructor and teaches all ages and skill levels players ranging from weekend to professional tournament players. Mandeo tries to enhance every player's skills and help them in bringing the best out of them. If you want to know more about his professional and golf teaching career, check out his website Mandeo Singh Pathania

...

[1]: https://mandeopathania.com/ [2]: https://mandeopathania.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21