Suggested problems

Quality and Reliability Parts for your vehicle

June 16, 2020, 11:57 a.m. by Used Car Engines & Transmissions

Biological Motivation

Are you in search of [used engines and transmissions][1] for your vehicle? Confused from where to purchase? Unsure about the quality and reliability of your purchase don’t know what will be the best fit for your vehicle?

[1]: https://www.usedengines.us/used-car-engines.php

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21