Suggested problems

Ecommerce app development

June 11, 2020, 8:29 a.m. by Emilymathew

Biological Motivation

Retail Business Owners, Stop losing your loyal customers to the online competitors by launching your own e-Store in the glimpse of an eye. YelloStack – the best eCommerce Web Development Company in Saudi Arabia.

Our eCommerce Website takes your e-Store directly to the Customer’s door.

YelloStack – eCommerce Web App works in a simple manner for the traditional business owner to sell goods on an online platform with ease!

           Get the OrderProcess the OrderShip the Order

Harness your Business through – eCommerce Website Development Company in Saudi Arabia: 1. Increase Customer Engagement & Conversions: Close sales with 90% more engaging rate. The faster website with high-quality images, real-time videos and personalized online shopping product catalogue. This will increase the convenience in Online shopping.

  1. Personal In-Store Experience: We assume ourselves as a customer and design the site online route map to browse across various products based on customer preference. Our experts are capable of delivering the best eCommerce Web development Company in Saudi Arabia.

We build eCommerce Websites by understanding the Customer insights, product preference and their purchase pattern. Offering Personal In-store experience pampers the customers to shop more!

  1. Load Fast and Sell More! : It is scientifically proven that the human mind has no patience to wait beyond 8 Seconds for the Web-page to get loaded. So, we bring you a light built online Shopping Portal, which is capable of loading in a fraction of seconds.

Our Development team has a good reputation for being the best eCommerce Web Development Company in Saudi Arabia. We build lightweight websites to load quickly and sell more.

Engage customers with Product Catalogs, Images and Chat

Choose YelloStack eCommerce Website to Boost Business Growth: The following attributes facilitate more online sales;

  1. Delight your Customers from Purchase to Delivery: We use custom – build modules to facilitate rich customer shopping experience with a user-friendly product category structure flowchart. Focusing on specific Sales attributes with Master Data Management. Notify customers with suggestions for the “products – they may like”, etc will obviously delight customers from starting to end.

  2. We never let you lose the sale:

    Buy any products any time

Offer Store like experience by providing birthday rap or deliver the product with thanks/greeting message at their doorstep. Letting the customers browse across various colours or the sizes of their choice. Yello Stack provides you with the best eCommerce Mobile App in Saudi Arabia and ensures you never lose even a single Sale.

  1. Enable Single Window Sales: Yello Stack Single Window eCommerce Sales portal offers you “Single Click – Delivery” feature for the customers to buy any products from anywhere at any time.

Advantages of our e-Store: Your favorite product is just a click away !

Tried and Tested eCommerce Platform with pre-built templates for multiple product verticals. Get your dream online Store Build in Short time at an economical price. Single window inventory management facility to reduce out of stock or overstocking scenarios. Multi-platform support Lightweight eCommerce Mobile & Web Store. Multi-lingual & multi-currency compatible eCommerce Web Development Service in Saudi Arabia. Stay ahead with Customer- focused Online Store:

Yello Stack – offers you the best eCommerce Web Development Service in Saudi Arabia.

Our eCommerce Web Store consists of 1. Inventory Management 2. Warehouse Management 3. Stock Management 4. Database Management 5. Client Relationship Management 6. Multi-Vendor Management 7. Marketing & Loyalty Programs 8. Bill Payment Management

To be the best in your eCommerce business, it is vital to choose the right partner. Choose YelloStack – The Best eCommerce Web Development Company in Saudi Arabia and Start increasing your Online Sales.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21