Suggested problems

Mac optimizer pro

June 5, 2020, 5:47 p.m. by David Carter

Biological Motivation

You will be surprised to find that forgotten apps take up a huge chunk of your disk space. This is especially relevant for Macs with a small flash storage. We are aware that free Mac cleaning tools are tempting to download, but why fill your limited disk space up with the trial versions of apps that have been downloaded to find out whether they fit your needs when we have already done that for you? We point out how to get access to trial versions of the best Mac cleanup programs and which free features and services you can expect [mac optimizer pro][1]

...

[1]: https://www.macoptimizerpro.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21