Suggested problems

Ухоженные мужчины

May 31, 2020, 11:02 a.m. by Elisabet

Biological Motivation

Всегда нравится, когда умужчин классная стрижка, ухоженная бородка, стильный внешний вид. Мужчины стали больше следить за собой. Мой парень посещает GC Barbershop[gentlemensclub.com.ua][1] Это очень стильное и элитное место с определенной атмосферой, где мужчины могут пообщаться, выпить виски, выкурить сигару. Здесь конечно дороговато, но стрижка моего мужа выглядит идеально. Хотя волосы у него жесткие, но профессиональные барберы идеально с ними управляются. Советую все мужчинам посетить GC Barbershop

...

[1]: http://%20https://gentlemensclub.com.ua

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21