Suggested problems

Nuclear Power and Climate Change

May 12, 2020, 6:06 p.m. by lindatyler

Biological Motivation

Climate change leads to various environmental effects. This essay will discuss the potential of nuclear power generation in limiting the emission of carbon and other greenhouse gases. Some of the issues that were considered include emission of low carbon through nuclear power generation, reduction of greenhouse gases through nuclear power applications, and introduction of clean coal technologies through nuclear power. Due to the positive environmental characteristics of nuclear power in controlling climate change, the issues of increasing the nuclear power generation are also taken into consideration based on the availability of uranium necessary for its production. The importance of nuclear power in solving the issue of climate change as well as the cost of developing nuclear power plants is also discussed. Nuclear Power and Climate Change The world is increasingly demanding more energy, especially because of the rapid industrialization being witnessed in the developing nations. The changes will cause the expansion in energy production which involves the use of fossil fuels and as a result will increase the emission of greenhouse gasses. The greenhouse gases and carbon dioxide are the major contributors to the growing global warming conditions. Its g effects include the rising of seas and severe weather conditions around the world. Recent developments in the nuclear energy production, however, suggest that nuclear power could be the solution to the increasing global warming effects. Nuclear power could potentially play a significant role in decreasing the emission of the greenhouse gases, since it does not produce any carbon dioxide or greenhouse gasses. This paper will analyze the role that nuclear energy can play in reducing the pace of climate change. Low Carbon Emissions Compared to other forms of energy, nuclear power causes low carbon emissions. Carbon is one of the primary greenhouse gases and contributes to the climate change significantly. Over 61% of the overall emissions responsible for global warming include carbon. Most the carbon released into the atmosphere is the result of burning of fossil fuels. The greenhouse gases could be reduced if newer technologies in the production of nuclear power were be used. The modern methods include changing the electricity diffusion of uranium enrichment, increasing power plant lifetime, and reducing burn-up. The global use of nuclear power by 2014 was 1.6%. It means that nuclear power contributed only 1% to the mitigation of greenhouse gases, hence reducing climate change by the same margin. According to International Atomic Energy Agency, coal is often used to produce large amounts of energy. However, coal causes significant amounts of CO2 emissions. Nuclear power, on the other hand, provides solutions to both large energy production and low level of carbon emission. The production of such may be achieved at low cost since it is already practiced across the world. The important thing in producing energy is to ensure high energy levels while conserving the environment. Nuclear power could thus be a potential solution to the reduction of carbon emissions and hence mitigation of the effects of climate changes. Avoiding GHGs Emission Apart from being used as a source for producing electricity, nuclear energy can also be used in other applications which help to reduce carbon emissions. For instance, nuclear power has been used in the desalination of seawater. Desalination processes are commonly done in areas which lack water countries in North Africa with vast desserts. The primary source of energy in the desalination processes is fossil fuel which emits high amounts of carbon into the atmosphere. Nuclear desalination plants could thus be of great importance in these countries. The other significant application of nuclear power that reduces the amount of carbon emission includes the extraction of high viscosity oil. The high amount of energy in the form of fossil fuel is often used in the extraction and refining of high viscosity oils. Canada, for example, uses high fossil fuels to extract oil from the sand. Powering Clean Coal Technologies Coal is important in modern energy production. Energy from coal contributes to 23% of primary energy i.e. used in the production of steel. However, due to its high carbon emissions, it is considered a threat to the climate. Nuclear power, however, if used instead of fossil fuels will help in the reduction of the amount of emissions. The high amount of energy from nuclear reactions can be used in the gasification of coal. Gasified coal can be combined with nuclear energy to help the combustion process. Gasified coal combustion limits the amount of greenhouse gas emissions. Resources to Increase Nuclear Power Nuclear power is generated from the burning of uranium. Countries rich in uranium deposits have the potential to increase the use of nuclear power hence contribute to the global struggle for of greenhouse gasses. According to IAEA, the available resources with the current rate of consumption are estimated to be available for over hundred years. Much of the global deposits of uranium are concentrated in Australia, Kazakhstan, Russia and the USA. However, others countries also have substantial amounts of the uranium ore deposits that could be used in the generation of nuclear power. As discussed, the nuclear power station emits minimum carbon dioxide. Ensuring an increase in the generation of nuclear power would limit the global emission of the greenhouse gasses. Most importantly is the fact that the availability of uranium does not limit the expansion of nuclear power generation. If to increase the generation of nuclear power across the globe, it could assist in solving the issue of the climate change. Competitive Costs of Nuclear Power Generation The estimated costs of power generation by a nuclear or a hydroelectric power plant are almost similar. This means that when considering which kind of power generation plant to choose for a country, the government or private investors have two variants to pick from. However, the primary costs involved in construction of a nuclear plant are often higher. This often leads to the rejection of this source of power. Although the front costs are high, these costs can be considered competitive. Despite the fact that it is expensive to develop a nuclear plant, it is less expensive to operate it. The need to reduce climate changes is vital for the mankind, and every necessary step should be taken to ensure it is kept under control. The effects of climate change have been devastating i.e. flooding due to the rising of the sea level, as well as desertification processes in various regions across the globe. Climate change is the result of the generation of the high amounts of energy by man with carbon dioxide and other greenhouse gases being its production byproduct. Nuclear power, however, has been proven to provide clean energy despite its drawbacks i.e. high costs of development. Use of fossil fuels results in over 61% of carbon and other greenhouse gasses emissions globally. Nuclear power, on the other hand, does not emit any GHGs. This means that an increase in the use of nuclear power will be crucial to the limitation of greenhouse gases emissions as well as controlling climate change.

About author Linda works as an editor at https://essaysservice.com/writing-a-quality-thesis-proposal.html. She has always enjoyed working with a variety of literature and being interested in new facts. In addition, she easily finds common ground with many people. She also received her master's degree from American University Washington

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21