Suggested problems

Yahoo Mail Error Code 15- How to Troubleshoot It?

May 11, 2020, 4:27 p.m. by James rise

Biological Motivation

Yahoo error codes are provisional in nature; however, some individuals do find them tough to resolve it. Among many errors related to Yahoo, the [url=https://www.dialhumanhelp.com/yahoo/]Yahoo Mail Error Code 15[/url] is the distinctive one. In case, if you are facing such error, don’t get worried, you are just little bit away, with the help of our Yahoo executives, you can get your issue fixed in a time. ...

[1]:

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21